blast: import from homebrew/science

Closes #22073.

Signed-off-by: ilovezfs <ilovezfs@icloud.com>

Formula/blast.rb

@@ -0,0 +1,43 @@
+class Blast < Formula
+  desc "Basic Local Alignment Search Tool"
+  homepage "https://blast.ncbi.nlm.nih.gov/"
+  url "https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.6.0/ncbi-blast-2.6.0+-src.tar.gz"
+  mirror "ftp://ftp.hgc.jp/pub/mirror/ncbi/blast/executables/blast+/2.6.0/ncbi-blast-2.6.0+-src.tar.gz"
+  version "2.6.0"
+  sha256 "0510e1d607d0fb4389eca50d434d5a0be787423b6850b3a4f315abc2ef19c996"
+  revision 3
+
+  depends_on "python" if MacOS.version <= :snow_leopard
+
+  # Remove for > 2.6
+  patch do
+    url "https://raw.githubusercontent.com/Homebrew/formula-patches/5fa7fda60c17a2a31e402522d0f7e5584d3b946b/blast/blast-make-fix2.5.0.diff"
+    sha256 "ab6b827073df48a110e47b8de4bf137fd73f3bf1d14c242a706e89b9c4f453ae"
+  end
+
+  def install
+    cd "c++" do
+      # Use ./configure --without-boost to fix
+      # error: allocating an object of abstract class type 'ncbi::CNcbiBoostLogger'
+      # Boost is used only for unit tests.
+      # See https://github.com/Homebrew/homebrew-science/pull/3537#issuecomment-220136266
+      system "./configure", "--prefix=#{prefix}",
+                            "--without-debug",
+                            "--without-boost"
+
+      # Fix the error: install: ReleaseMT/lib/*.*: No such file or directory
+      system "make"
+
+      system "make", "install"
+    end
+  end
+
+  test do
+    (testpath/"test.fasta").write <<~EOS
+      >U00096.2:1-70
+      AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
+    EOS
+    output = shell_output("#{bin}/blastn -query test.fasta -subject test.fasta")
+    assert_match "Identities = 70/70", output
+  end
+end