class Augustus < Formula desc "Predict genes in eukaryotic genomic sequences" homepage "http://bioinf.uni-greifswald.de/augustus/" url "https://github.com/Gaius-Augustus/Augustus/releases/download/v3.3.3/augustus-3.3.3.tar.gz" sha256 "4cc4d32074b18a8b7f853ebaa7c9bef80083b38277f8afb4d33c755be66b7140" head "https://github.com/Gaius-Augustus/Augustus.git" bottle do cellar :any sha256 "397da54388ec9d56ee891b021fe313e0e4cfa2e46e80ef177ddd6d24723abec3" => :catalina sha256 "67298cd2aa811dfa953f8d0c9019df12fe2f7aec6cd35ebf1cf27e38fb39e858" => :mojave sha256 "030d9fced4d6863a77e5058f145e2d13560ef0b9aedd1cb01e96c593c9e3cbc6" => :high_sierra end depends_on "boost" => :build depends_on "bamtools" depends_on "gcc" def install # Avoid "fatal error: 'sam.h' file not found" by not building bam2wig inreplace "auxprogs/Makefile", "cd bam2wig; make;", "#cd bam2wig; make;" # Fix error: api/BamReader.h: No such file or directory inreplace "auxprogs/bam2hints/Makefile", "INCLUDES = /usr/include/bamtools", "INCLUDES = #{Formula["bamtools"].include/"bamtools"}" inreplace "auxprogs/filterBam/src/Makefile", "BAMTOOLS = /usr/include/bamtools", "BAMTOOLS= #{Formula["bamtools"].include/"bamtools"}" # Prevent symlinking into /usr/local/bin/ inreplace "Makefile", %r{ln -sf.*/usr/local/bin/}, "#ln -sf" # Compile executables for macOS. Tarball ships with executables for Linux. system "make", "clean" # Clang breaks proteinprofile on macOS. This issue has been first reported # to upstream in 2016 (see https://github.com/nextgenusfs/funannotate/issues/3). # See also https://github.com/Gaius-Augustus/Augustus/issues/64 cd "src" do with_env("HOMEBREW_CC" => "gcc-9") do system "make" end end system "make" system "make", "install", "INSTALLDIR=#{prefix}" bin.env_script_all_files libexec/"bin", :AUGUSTUS_CONFIG_PATH => prefix/"config" pkgshare.install "examples" end test do (testpath/"test.fasta").write <<~EOS >U00096.2:1-70 AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC EOS cmd = "#{bin}/augustus --species=human test.fasta" assert_match "Predicted genes", shell_output(cmd) cp pkgshare/"examples/example.fa", testpath cp pkgshare/"examples/profile/HsDHC.prfl", testpath cmd = "#{bin}/augustus --species=human --proteinprofile=HsDHC.prfl example.fa 2> /dev/null" assert_match "HS04636 AUGUSTUS gene 966 6903 1 + . g1", shell_output(cmd) end end