class Blast < Formula desc "Basic Local Alignment Search Tool" homepage "https://blast.ncbi.nlm.nih.gov/" url "https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/ncbi-blast-2.7.1+-src.tar.gz" mirror "http://mirrors.vbi.vt.edu/mirrors/ftp.ncbi.nih.gov/blast/executables/LATEST/ncbi-blast-2.7.1+-src.tar.gz" version "2.7.1" sha256 "10a78d3007413a6d4c983d2acbf03ef84b622b82bd9a59c6bd9fbdde9d0298ca" bottle do sha256 "13e0286489e2b28adbe3fc6ef82a26f3e081b44a0ce99f3212a0c4d7da981b3a" => :high_sierra sha256 "a868633034dc12160109ee44e5415577967e2ceabaad3246881abaf07c57a198" => :sierra sha256 "110a62423f43f3618aadc5a149c238302af30399426346e571e23f252f8e6bab" => :el_capitan end depends_on "lmdb" depends_on "python" if MacOS.version <= :snow_leopard def install cd "c++" do # Use ./configure --without-boost to fix # error: allocating an object of abstract class type 'ncbi::CNcbiBoostLogger' # Boost is used only for unit tests. # See https://github.com/Homebrew/homebrew-science/pull/3537#issuecomment-220136266 system "./configure", "--prefix=#{prefix}", "--without-debug", "--without-boost" # Fix the error: install: ReleaseMT/lib/*.*: No such file or directory system "make" system "make", "install" end end test do (testpath/"test.fasta").write <<~EOS >U00096.2:1-70 AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC EOS output = shell_output("#{bin}/blastn -query test.fasta -subject test.fasta") assert_match "Identities = 70/70", output end end